Please wait a minute...
Journal of Molecular and Clinical Medicine   2018, Vol. 1 Issue (3): 127-134    DOI: 10.31083/j.jmcm.2018.03.001
Research article | Next articles
Identification of appropriate housekeeping genes for quantitative RT-PCR analysis in MDA-MB-231 and NCI-H460 human cancer cell lines under hypoxia and serum deprivation
Amanda P. B. Albuquerque1, 2, Meritxell Balmaña3, 4, Celso A. Reis3, 4, 5, 6, *(), Eduardo I.C. Beltrão1, 2, *()
1 Biomarkers in Cancer Research Group (BmC) - Federal University of Pernambuco (UFPE), 50670-901 Recife, Brazil
2 Department of Biochemistry- Federal University of Pernambuco (UFPE), 50670-420 Recife, Brazil
3 Instituto de Investigação e Inovação em Saúde, Universidade do Porto, 4200-135 Porto, Portugal
4 Institute of Molecular Pathology and Immunology, University of Porto, 4200-135 Porto, Portugal
5 Institute of Biomedical Sciences Abel Salazar, University of Porto, 4050-313 Porto, Portugal
6 Faculty of Medicine, University of Porto, 4200-319 Porto, Portugal
Download:  PDF(561KB)  ( 148 ) Full text   ( 99 )
Export:  BibTeX | EndNote (RIS)      
Abstract  

Gene expression studies aimed at analyzing cancer cells under hypoxia and serum deprivation conditions show major potential for understanding molecular mechanisms associated with tumor progression as well as resistance to antitumor agents. To the best of our knowledge, a study for the identification of appropriate housekeeping genes in breast and lung cancer cells under hypoxia and serum deprivation conditions is currently missing. Given the relevance of a reliable and accurate normalization, we herein aimed to identify the appropriate housekeeping genes for breast and lung cancer cell lines cultured under hypoxia and/or serum deprivation. The stability of five commonly used housekeeping genes (ACTB, β2M, GUSB, 18S rRNA, and PPIA) was assessed after reverse-transcription quantitative real-time PCR in MDA-MB-231 and NCI-H460 cancer cell lines using GeNorm, NormFinder and BestKeeper software. GeNorm and NormFinder ranking revealed ACTB, GUSB and PPIA as the most stable genes for both tumor cell lines. Our results support the use of ACTB/PPIA for MDA-MB-231 and GUSB/PPIA for NCI-H460 cells as the most stable combination for normalization of gene expression under hypoxic and serum deprivation conditions. Our results highlight the importance of the selection of the housekeeping genes in cancer cells subjected to different physiological stresses, such as hypoxia and serum deprivation.

Key words:  Breast cancer      Housekeeping genes      Hypoxia      Lung cancer      RT-qPCR      Serum deprivation     
Submitted:  29 March 2018      Revised:  29 May 2018      Accepted:  06 July 2018      Published:  20 September 2018     
*Corresponding Author(s):  Celso A. Reis,Eduardo I.C. Beltrão     E-mail:  celsor@ipatimup.pt;ebeltrao@hotmail.com

Cite this article: 

Amanda P. B. Albuquerque, Meritxell Balmaña, Celso A. Reis, Eduardo I.C. Beltrão. Identification of appropriate housekeeping genes for quantitative RT-PCR analysis in MDA-MB-231 and NCI-H460 human cancer cell lines under hypoxia and serum deprivation. Journal of Molecular and Clinical Medicine , 2018, 1(3): 127-134.

URL: 

https://jmcm.imrpress.com/EN/10.31083/j.jmcm.2018.03.001     OR     https://jmcm.imrpress.com/EN/Y2018/V1/I3/127

Table 1  Primer sequences used for the expression analysis of housekeeping genes
Symbol Gene name Primer sequences (5→3’) Product size/bp R2 E(%)
ACTB Actin, beta F: agaaaatctggcaccacacc R: tagcacagcctggatagcaa 173 0.99 90
β2M Beta-2-microglobulin F: agcgtactccaaagattcaggtt R: atgatgctgcttacatgtctcgat 206 1 105
GUSB Beta-glucuronidase F: agccagttcctcatcaatgg R: ggtagtggctggtacggaaa 160 1 90
PPIA Peptidylprolyl isomerase A F: agacaaggtcccaaagac R: accaccctgacacataaa 118 1 100
18S 18S ribosomal F: cgccgctagaggtgaaattc R: cattcttggcaaatgctttcg 67 0.99 90
Fig. 1.  Mean Ct values of HKG candidates. (A) MDA-MB-231 and (B) NCI-H460 cells cultured in normoxia with FBS supplementation (21% O$_{2}$, 10% FBS$_{ }$-N10), hypoxia with FBS supplementation (1% O$_{2}$, 10% FBS$_{ }$-H10) and normoxia and hypoxia without FBS supplementation, N0 and H0, respectively, for 48 h. Data are expressed as the mean $\pm $ standard deviation. Ct, threshold cycle.

Fig. 2.  Expression stability values of HKG candidates analyzed by GeNorm, NormFinder and BestKeeper softwares. GeNorm average expression stability measures (M) of HKG candidates in MDA-MB-231 (A) and NCI-H460 (B) cell lines. NormFinder ranking of HKG candidates and their expression stability in MDA-MB-231 (C) and NCI-H460 (D) cell lines. Correlation coefficient ($r)$ values of the HKG candidates analyzed by BestKeeper software in MDA-MB-231 (E) and NCI-H460 (F) cell lines.

[1] Bustin SA . Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol, 2000; 25(2):169s-193s.
[2] Ginzinger DG . Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp Hematol, 2002; 30(6):503s-512s.
doi: 10.1016/S0301-472X(02)00806-8 pmid: 12063017
[3] Bustin SA, Murphy J . RNA biomarkers in colorectal cancer. Methods, 2013; 59(1):116s-125s.
doi: 10.1016/j.ymeth.2012.10.003 pmid: 23079397
[4] De Kok JB, Roelofs RW, Giesendorf BA, Pennings JL, Wass ET, Feuth T , et al. Normalization of gene expression measurements in tumor tissues: comparison of 13 endogenous control genes. Lab Invest, 2005; 85(1):154s-159s.
doi: 10.1038/labinvest.3700208 pmid: 15543203
[5] Jacob F, Guertler R, Naim S, Nixdorf S, Fedier A, Hacker RF , et al. Careful selection of reference genes is required for reliable performance of RT-qPCR in human normal and cancer cell lines. PLoS One, 2013; 8(3):e59180.
doi: 10.1371/journal.pone.0059180 pmid: 3598660
[6] Caradec J, Sirab N, Keumeugni C, Moutereau S, Chimingqi M, Matar C , et al. `Desperate house genes': the dramatic example of hypoxia. Br J Cancer, 2010; 102(6):1037s-1043s.
doi: 10.1038/sj.bjc.6605573 pmid: 2844028
[7] Bakhashab S, Lary S, Ahmed F, Schulten HJ, Bashir A, Ahmed FW , et al. Reference genes for expression studies in hypoxia and hyperglycemia models in human umbilical vein endothelial cells. G3 (Bethesda), 2014; 4(11):2159s-2165s.
doi: 10.1534/g3.114.013102 pmid: 4232541
[8] Said HM, Polat B, Hagemann C, Anacker J, Flentje M, Vordermark D . Absence of GAPDH regulation in tumor-cells of different origin under hypoxic conditions in vitro. BMC Res Notes, 2009; 13(2):8.
doi: 10.1186/1756-0500-2-8 pmid: 19144146
[9] Higashimura Y, Nakajima Y, Yamaji R, Harada N, Shibasaki F, Nakano Y , et al. Up-regulation of glyceraldehyde-3-phosphate dehydrogenase gene expression by HIF-1 activity depending on Sp1 in hypoxic breast cancer cells. Arch Biochem Biophys, 2011; 509(1):1s-8s.
doi: 10.1016/j.abb.2011.02.011 pmid: 21338575
[10] Vajda A, Marignol L, Barrett C, Madden SF, Lynch TH, Hollywood D , et al. Gene expression analysis in prostate cancer: the importance of the endogenous control. Prostate, 2013; 73(4):382s-390s.
doi: 10.1002/pros.22578 pmid: 22926970
[11] Krzystek-Korpacka M, Hotowy K, Czapinska E, Podkowik M, Bania J, Gamian A , et al. Serum availability affects expression of common housekeeping genes in colon adenocarcinoma cell lines: implications for quantitative real-time PCR studies. Cytotechnology, 2016; 68(6):2503s-2517s.
doi: 10.1007/s10616-016-9971-4 pmid: 27339468
[12] Wang H, Yang B, Geng T, Li B, Dai P, Chen C . Tissue-specific selection of optimal reference genes for expression analysis of anti-cancer drug-related genes in tumor samples using quantitative real-time RT-PCR. Exp Mol Pathol, 2015; 98(3):375s-381s.
doi: 10.1016/j.yexmp.2014.10.014 pmid: 25445497
[13] Normann KR, Oystese KAB, Berg JP, Lekva T, Berg-Johnsen JB, Jens O , et al. Selection and validation of reliable reference genes for RT-qPCR analysis in a large cohort of pituitary adenomas. Mol Cell Endocrinol, 2016; 5(437):183s-189s.
doi: 10.1016/j.mce.2016.08.030 pmid: 27561203
[14] Vandesompele J, De Preter K, Pattyn I, Poppe B, Van Roy N, De Paepe A , et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol, 2002; 3(7):0034.
[15] Andersen CL, Ledet-Jensen J, Orntoft TF . Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res, 2004; 64(15):5245s-5250s.
[16] De Spiegelaere W, Dern-Wieloch J, Weigel R, Schumacher V, Schorle H, Nettersheim D , et al. Reference gene validation for RT-qPCR, a note on different available software packages. PLoS One, 2015; 10(3):1s-13s.
doi: 10.1371/journal.pone.0122515 pmid: 25825906
[17] Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP . Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper - Excel-based tool using pair-wise correlations. Biotechnol Lett, 2004; 26(6):509s-515s.
[18] Jung S, Li C, Duan J, Soonduck L, Kyeri K, Yeonji P , et al. TRIP-Br1 oncoprotein inhibits autophagy, apoptosis, and necroptosis under nutrient/serum-deprived condition. Oncotarget, 2015; 6(30):29060s-29075s.
doi: 10.18632/oncotarget.5072 pmid: 4745711
[19] Wu CY, Guo XZ, Li HY . Hypoxia and Serum deprivation protected MiaPaCa-2 cells from KAI1-induced proliferation inhibition through autophagy pathway activation in solid tumors. Clin Transl Oncol, 2015; 17(3):201s-208s.
doi: 10.1007/s12094-014-1211-9 pmid: 25199507
[20] Albuquerque APB, Balmaña M, Mereiter S, Pinto F, Reis CA, Beltrão EIC . Hypoxia and serum deprivation induces glycan alterations in triple negative breast cancer cells. Biol Chem, 2018; 399(7):661s-672s.
doi: 10.1515/hsz-2018-0121
[21] Liu LL, Zhao H, Ma TF, Ge F, Chen CS, Zhang YP . Identification of valid reference genes for the normalization of RT-qPCR expression studies in human breast cancer cell lines treated with and without transient transfection. PLoS One, 2015; 10(1):e0117058.
doi: 10.1371/journal.pone.0117058 pmid: 25617865
[22] Liu DW, Chen ST , Liu, HP. Choice of endogenous control for gene expression in non-small cell lung cancer. Eur Respir J, 2005; 26(6):1002s-1008s.
doi: 10.1183/09031936.05.00050205 pmid: 16319328
[23] Brugè F, Venditti E, Tiano L, Littarru GP, Damiani E . Reference gene validation for qPCR on normoxia- and hypoxia-cultured human dermal fibroblasts exposed to UVA: is beta-actin a reliable normalizer for photoaging studies? J Biotechnol, 2011; 156(3):153s-162s.
[24] Ali H, DU Z, Li X, Yang Q, Zhang YC, Wu M, Li Y , et al. Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro. Mol Med Rep, 2015; 11(5):3767s-3773s.
doi: 10.3892/mmr.2015.3159 pmid: 25573171
[25] Lima L, Gaiteiro C, Peixoto A, Soares J, Neves M, Santos LL , et al. Reference Genes for Addressing Gene Expression of Bladder Cancer Cell Models under Hypoxia: A Step Towards Transcriptomic Studies. PLoS One, 2016; 11(11):e0166120.
doi: 10.1371/journal.pone.0166120 pmid: 27835695
[26] Moein S, Javanmard SH, Abedi M, Izadpanahi MH, Gheisari YF . Identification of Appropriate Housekeeping Genes for Gene Expression Analysis in Long-term Hypoxia-treated Kidney Cells. Adv Biomed Res, 2017; 6:15.
doi: 10.4103/2277-9175.200790 pmid: 5343613
[27] Hanahan D, Weinberg RA . Hallmarks of cancer: the next generation. Cell, 2011; 144(5):646s-74s.
[28] Reis-Filho JS, Pusztai L . Gene expression profiling in breast cancer: classification, prognostication, and prediction. Lancet, 2011; 378(9805):1812s-1823s.
doi: 10.1016/S0140-6736(11)61539-0 pmid: 22098854
[29] Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H , et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci USA, 2001; 98(19):10869s-10874s.
[30] Foldager CB, Munir S, Ulrik-Vinther M, Soballe K, Bünger C, Lind M . Validation of suitable housekeeping genes for hypoxia-cultured human chondrocytes. BMC Mol Biol, 2009; 10:94.
[31] Chey S, Claus C, Liebert UG . Validation and application of normalization factors for gene expression studies in Rubella virus-infected cell lines with quantitative real-time PCR. J Cell Biochem, 2010; 110(1):118s-128s.
doi: 10.1002/jcb.22518 pmid: 20217898
[32] He YX, Zhang Y, Yang Q, Wang C, Su G . Selection of suitable reference genes for reverse transcription-quantitative polymerase chain reaction analysis of neuronal cells differentiated from bone mesenchymal stem cells. Mol Med Rep, 2015; 12(2):2291s-2300s.
doi: 10.3892/mmr.2015.3671 pmid: 25936423
[33] Liu X, Xie J, Liu Z, Gong Q, Tian R, Su G . Identification and validation of reference genes for quantitative RT-PCR analysis of retinal pigment epithelium cells under hypoxia and/or hyperglycemia. Gene, 2016; 580(1):41s-46s.
doi: 10.1016/j.gene.2016.01.001 pmid: 26772907
[34] Sharan RN, Vaiphei ST, Nongrum S, Keppen J, Ksoo M . Consensus reference gene(s) for gene expression studies in human cancers: end of the tunnel visible? Cell Oncol, 2015; 38(6):419s-431s.
doi: 10.1007/s13402-015-0244-6 pmid: 26384826
[35] Baddela VS, Baufeld AY, Vengala R, Vanselow J, Singh D . Suitable housekeeping genes for normalization of transcript abundance analysis by real-time RT-PCR in cultured bovine granulosa cells during hypoxia and differential cell plating density. Reprod Biol Endocrinol, 2014; 12:118.
doi: 10.1186/1477-7827-12-118 pmid: 25430436
[36] Tan SC, Carr CA, Yeoh KK, Schofield JC, Davies KE, Clarke K . Identification of valid housekeeping genes for quantitative RT-PCR analysis of cardiosphere-derived cells preconditioned under hypoxia or with prolyl-4-hydroxylase inhibitors. Mol Biol Rep, 2012; 39(4):4857s-4867s.
doi: 10.1007/s11033-011-1281-5 pmid: 22065248
[37] Majidzadeh AK, Esmaeili R, Abdoli N . TFRC and ACTB as the best reference genes to quantify Urokinase Plasminogen Activator in breast cancer. BMC Res Notes, 2011; 4:215.
doi: 10.1186/1756-0500-4-215 pmid: 3141519
[38] Chen B, Yuping S, Ni J . Rapamycin decreases survivin expression to induce NSCLC cell apoptosis under hypoxia through inhibiting HIF-1a induction. Mol Biol Rep, 2012; 39(1):185s-191s.
doi: 10.1007/s11033-011-0724-3 pmid: 21567203
[39] Sorby LA, Andersen SN, Bukholm IRK, Jacobsen MB . Evaluation of suitable reference genes for normalization of real-time reverse transcription PCR analysis in colon cancer. J Exp Clin Cancer Res, 2010; 29:144.
doi: 10.1186/1756-9966-29-144 pmid: 2988724
[40] Ali H, Du Z, Li X, Yang Q, Zhang YC, Wu M , et al. Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro. Mol Med Rep, 2015; 11(5):3767s-3773s.
doi: 10.3892/mmr.2015.3159 pmid: 25573171
[41] Andrusiewicz M, Slowikowski B, Skibinska I, Wolun-Cholewa M, Dera-Szymanowska A . Selection of reliable reference genes in eutopic and ectopic endometrium for quantitative expression studies. Biomed Pharmacother, 2016; 78:66s-73s.
doi: 10.1016/j.biopha.2015.12.028 pmid: 26898426
[42] Lemma S, Avnet S, Salerno M, Chano T, Baldini N . Identification and validation of housekeeping genes for gene expression analysis of cancer stem cells. PLoS One, 2016; 11(2):e0149481.
doi: 10.1371/journal.pone.0149481 pmid: 4760967
[43] Yao L, Chen X, Tian Y, Lu H, Zhang P, Shi Q , et al. Selection of housekeeping genes for normalization of RT-PCR in hypoxic neural stem cells of rat in vitro. Mol Biol Rep, 2012; 39(1):569s-576s.
doi: 10.1007/s11033-011-0772-8 pmid: 21633896
[1] Adrián Puerta, Alexis R. Galán, Roderick Abdilla, Kaylie Demanuele, Miguel X. Fernandes, Giovanna Bosica, José M. Padrón. Naphthol-derived Betti bases as potential SLC6A14 blockers[J]. Journal of Molecular and Clinical Medicine , 2019, 2(2): 35-40.
[2] Irene Lagunes, Elva Martín-Batista, Gastón Silveira-Dorta, Miguel X. Fernandes, José M. Padrón. Differential mechanism of action of the CK1$\varepsilon $ inhibitor GSD0054[J]. Journal of Molecular and Clinical Medicine , 2018, 1(2): 77-84.
[3] Sohvi Blatter, Nadine Stokar-Regenscheit, Ariena Kersbergen, Charlotte Guyader, Sven Rottenberg. Chemotherapy induces an immunosuppressive gene expression signature in residual BRCA1/p53-deficient mouse mammary tumors[J]. Journal of Molecular and Clinical Medicine , 2018, 1(1): 7-17.
[1] Evgeniy A. Cheremushkin,Nadezda E. Petrenko,Irina A. Yakovenko,Sergei A. Gordeev,Nikolay N. Alipov,Olga V. Sergeeva. Human neurophysiological markers of high anxiety level during preparation for visual recognition[J]. Journal of Integrative Neuroscience, 2018, 17(3): 193 -202 .
[2] Miao Xie, Geng Zhang, Wei Yin, Xin-Xin Hei, Tao Liu. Cognitive enhancing and antioxidant effects of tetrahydroxystilbene glucoside in Aβ1-42-induced neurodegeneration in mice[J]. Journal of Integrative Neuroscience, 2018, 17(3): 203 -210 .
[3] Andrey F. Iznak,Ekaterina V. Iznak,Tatiana P. Klyushnik,Georgy M. Kobel'kov,Elena V. Damjanovich,Igor V. Oleichik,Lilia I. Abramova. Neurobiological parameters in quantitative prediction of treatment outcome in schizophrenic patients[J]. Journal of Integrative Neuroscience, 2018, 17(3): 221 -228 .
[4] Renata S. Marcomini,Ana Claúdia F. Frizzo,Viviane B. de Góes,Simone F. Regaçone,David M. Garner,Rodrigo D. Raimundo,Fernando R. Oliveira,Vitor E. Valenti. Association between heart rhythm and cortical sound processing[J]. Journal of Integrative Neuroscience, 2018, 17(3): 229 -236 .
[5] Elham Askari,Seyed Kamaledin Setarehdan,Ali Sheikhani,Mohammad Reza Mohammadi,Mohammad Teshnehlab. Computational model for detection of abnormal brain connections in children with autism[J]. Journal of Integrative Neuroscience, 2018, 17(3): 237 -248 .
[6] J. Meléndez-Gallardo,A. Eblen-Zajjur. Thermo-dependence of noxious mechanical heterotopic stimulation-dependent modulation of the spinal dorsal horn response to somatosensory stimulation[J]. Journal of Integrative Neuroscience, 2018, 17(3): 249 -256 .
[7] Xian Liu,Chunyu Zhao,Chengxia Sun,Zhanming Chen,Tasawar Hayat,Ahmed Alsaedi. A new closed-loop strategy for detection and modulation of epileptiform spikes based on cross approximate entropy[J]. Journal of Integrative Neuroscience, 2018, 17(3): 271 -280 .
[8] Marie Charlotte Gandolphe,Jean Louis Nandrino,Gérald Delelis,Claire Ducro,Audrey Lavallee,Xavier Saloppe,Ahmed A. Moustafa,Mohamad El Haj. Positive facial expressions during retrieval of self-defining memories[J]. Journal of Integrative Neuroscience, 2018, 17(3): 281 -286 .
[9] Gerardo Fernández,Nora P. Rotstein,Luis E. Politi,Liliana Castro,Osvaldo Agamennoni. Microsaccadic behavior when developing a complex dynamical activity[J]. Journal of Integrative Neuroscience, 2018, 17(3): 287 -290 .
[10] Abolfazl Alipour,Sahar Seifzadeh,Hadi Aligholi,Mohammad Nami. QEEG-based neural correlates of decision making in a well-trained eight year-old chess player[J]. Journal of Integrative Neuroscience, 2018, 17(3): 297 -306 .